Human Variation & Race

1. Heat negatively impacts the survival of humans by disturbing homeostasis because it can be costly and hazardous in terms of water and sodium loss. There are two kinds of heat – arid and humid. Arid heat is primarily found in the southwestern United States, Middle East, and in some parts of Africa. High temperatures, wind, and low water vapor is indicative of arid heat. Humid heat is primarily present in eastern and southern U.S., parts of Europe, and in the tropics. Unlike arid heat, humid heat is characterized by large amounts of water vapor. Increased water vapor obstructs the evaporation of sweat, which makes it less difficult for humans to adapt to dry heat. People who workout in areas with dry heat may be unaware they are sweating altogether, because it evaporates as soon as it reaches the surface of their skin. This rapid evaporation can quickly cause dehydration, which stresses the importance of staying hydrated, regardless if you are thirsty.

2. Humans have adapted to heat through several different effects including: short term, facultative, developmental and cultural. 

A short term response to heat could be something as simple as perspiration. Sweating is a natural reaction produced by the body’s cooling system. 

A facultative response to heat would be developing a slender body type, which would allow more heat to escape by sweating more efficiently. 

A developmental response to heat could be understanding the importance of drinking plenty of water. In areas where high temperatures are evident, staying hydrated is necessary for proper body functions. 

A cultural effect to heat is understanding the importance of clothing. People should dress appropriate and protect the skin from damage.

3. The importance of studying human variation is that it allows us to understand how people live in drastically different climates and environments. Being a native to a particular climate gives basis to the adaptation anyone has for survival. For example, living in Southern California has spoiled me into believing that anything below the mid-sixties is cold. This drastically limits the number of places I would be able to survive in the world.

4. I don’t believe race plays an actual role in human variation. Race is any people united by common history, language, and cultural traits. It is not defined by skin color. Environmental effects on adaptations lead to solid non-racial explanations for why people have become the way they are.

Language Blog

Part 1:  You were asked to engage in a conversation for 15 minutes where you were not allowed to use any version of a symbolic language (no speaking, writing, or ASL).

Did you find this experiment difficult or easy?  The experiment was much more difficult than I expected it to be. Throughout the entire conversation, I had an urge to put in my input, but I had to suppress the urge and sit there diligently.

What were the impressions of partners in the conversation?  Did they alter their way of

communicating with you because of your absence of symbolic communication? I am somewhat of a social butterfly amongst my group of friends. I’m the loudest and the one that is always talking, so my friends definitely seized their opportunity of me being unable to talk for fifteen minutes. Just to spite me, they discussed topics that they know I am passionate about and purposefully said things that I don’t agree with. All I could do was shake my head.

Imagine that you and your partners in the conversation represent two different cultures meeting for the first time.  Which culture has the advantage in communicating complex ideas?  I think my friends had a slight advantage over me, because they had the ability to discuss ideas freely amongst each other. However, given the hypothetical question, I believe a communication barrier would prevent both sides from having a real advantage.

What attitudes might the speaking culture have toward the culture that does not use symbolic language?  They would probably be frustrated with the non-speaking culture and would believe themselves to be intellectually superior.

Identify individuals in our culture that have difficulty communicating with spoken language and explore how that affects how those who do speak interact with those individuals. As Americans, we are exposed to many different cultures and languages all the time. Because of this, it is very common for both English speakers and other language speakers to become frustrated with one another, due to the communication barrier. I have had several jobs where I dealt with customers, who did not speak English. It was nearly impossible for both sides to be satisfied without the help of a translator. Other members of our culture who experienced great difficulty communicating with others are those who are deaf or mute. Sometimes for the deaf and or mute, effective communication can be achieved by writing back and forth or through the use of hand gestures. However, this requires a great deal of patience, due to the time it takes to go back and forth writing and the time it takes to write out thoughts and ideas so that the communication is complete.

Part 2:  You were asked to spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, not vocal intonation, not head, facial, or body movements.

 Were you able to last for the full 15 minutes of using only speech for communicating?  Yes, but it was extremely difficult, as I am somewhat of a dramatic speaker.

What made this experiment difficult for you? I feel that physical embellishments are an important aspect to all effective communication. It is what keeps our listeners attentive and interested in what we have to say. Without them, it is very easy for our words to become monotone and tiresome.  

 How were your partners in this part of the experiment affected by your communication?

limitations?  Without the use of physical embellishments, I was unable to capture the interest of my friends. They seized the opportunity to cut me off and talk over me.

What does this experiment say about our use of “signs” in our language, i.e., how important is non-speech language techniques in our ability to communicate effectively?  The use of signs in language is almost just as important as the words themselves. This is because; the signals bring life to the words. In some instances, body language can be even more effective, as people universally understand certain cues (such as happiness, sadness, excitement, sleepiness, etc.).

Are there people who have difficulty reading body language? I think a great deal of body language is universally understood. That being said, I think there are many different little quirks that vary from culture to culture that could be confusing or even offensive to members of other cultures. For example, in some cultures it is common for friends and family members to greet each other with a kiss, even those of the same sex. This could easily be misinterpreted in other cultures.  

Describe the adaptive benefit to possessing the ability to read body language. I believe the adaptive benefit to reading body language would be that there would be less miscommunication between individuals. And this could reduce the offense one might take from not knowing the body language of another culture.  

 Can you describe environmental conditions where there might be a benefit to not reading body language? The only environmental conditions where not reading body language might be an advantage is if we were placed in an environment where there is absolutely no foreseeable threat and we used our attention spans to listen what is on somebody’s mind rather than make our own assumptions. 

Piltdown hoax

1. Begin by giving a brief synopsis of the Piltdown hoax, including when and where it was found, by whom, and varying affects this had on the scientific community.  Also include how the hoax was discovered and the varying responses it received from the scientist(s) involved and in the related fields of human evolution. (5 pts)

Charles Dawson discovered the “Piltdown hoax” in 1912 in the village of Piltdown. The fossil skull was believed to be the missing link between humans and apes and was dubbed “Piltdown Man”. Piltdown man was very misleading to the science community, which resulted with many additional false claims by those analyzed it. When younger fossils were uncovered in Asia, Piltdown Man’s validity was questioned, as the new fossils lacked many of the human skull features that Piltdown Man had. The hoax brought attention to the fact that not all scientists are honest and not all of their work is genuine, which they were believed to be at the time.

2. Scientists are curious, creative and persistent by nature, but being human, they also have faults. What human faults come into play here in this scenario and how did these faults negatively impact the scientific process? (5 pts)

While scientists are curious, creative and persistent by nature, they are also human, so they are not exempt from having a few faults. One human fault that was evident in the Piltdown man scenario is jealousy. When Germany found the “Neanderthal”, Germany became the birthplace of man. Britain, wanting to hold the title of being the birthplace of man, forged the Piltdown man. This negatively impacted the scientific process because someone unknown felt the need to create the Piltdown man and make others believe it was real. Another human fault that was evident in the “Piltdown hoax” is gullibility. Scientist of Britain were extremely naive for believing the Piltdown fake was real and not questioning it until 40 years after it was discovered. It wasn't until 1949, when the fossils were dated using the fluorine absorption technique, that the authenticity of the "discovery" was called into question. It is true that the fluorine test was not around until many years after the hoax. However, the file marks upon the teeth, and the fact that the "wear" was backward, should have alerted other scientists right away.

3. What positive aspects of the scientific process were responsible for revealing the skull to be a fraud? Be specific about scientific tools, processes or methodologies that were involved in providing accurate information about the Piltdown skull. (5 pts)

With the aid of the fluorine absorption technique, scientists discovered that the skull belonged to an orangutan. The skull dated back less than 100 years, which means it wasn’t ancient at all. The bones were also determined to have chromic acid stains and iron solution alterations to make them look older. After further analysis it was also proven that the teeth had been filed down, as well as pieces of the jaw bone broken off to resemble that of a human.

4. Is it possible to remove the “human” factor from science to reduce the chance of errors like this from happening again? Would you want to remove the human factor from science? (10 pts)

I do not think that it is possible to remove the “human” factor. Human beings have such great determination to want to be the first to discover things and I extremely doubt that the desire will ever disappear. In order to prevent situations like this from happening again, it would be wise to always authenticate one’s work before proceeding. I would definitely not want to remove the human factor from science; otherwise scientists would not have the opportunity to be recognized for their findings that ultimately advance us as species.

5. Life lessons: What lessons can you take from this historical event regarding taking information at face value from unverified sources? (5 pts)

The lesson that I would take from this historical event would be; to verify and double check everything in order to make sure that my claims and results are truthful, so that I can have integrity.

Comparative Primate Blog Post

A. Environment

Lemurs: Lemurs are a type of primate that can only be found in Madagascar and the Comores Islands. Lemurs live in various habitats within these rainforest-like locations. Some lemurs prefer to live in the heart of the damp rainforest, while others prefer to reside in drier areas that resemble deserts.

Spider Monkey: Another primate that tends to live in the rain forests is the spider monkey. Spider monkeys live in tropical rainforests located in central and south America and can be found in far north as Mexico. Rain forests are ideal environments for these monkeys because of their vast number of tall trees, where spider monkeys create their habitats.  

Baboon: All five different species of Baboons can only be found in Arabia and Africa. These monkeys prefer to live in the Savanna, or other semi-arid habitats. Though, a few of them prefer the rainforest as well. 

Gibbon: These swinging monkeys reside in Southern Asia. They live in the trees and are rarely ever on the ground. 

Chimpanzee: The most common of all the primates are the Chimpanzees who range from living in communities in African rain forests, woodlands and grasslands. 

B. Diet

Lemurs: A lemur’s diet is made up of mostly leaves and fruits. Some occasionally eat insects, but they usually stick to a vegetarian diet.

Spider Monkey: Spider monkeys also eat fruits, but also enjoy various nuts. These monkeys prefer to swallow their fruit whole. Spider monkeys typically only eat from dawn until about 10 in the morning. They will eat bark and honey if they are still hungry throughout the day.  

Baboon: Baboons typically have large appetites. They tend to eat whatever they can get their hands on. They enjoy fruit, grass, seeds, roots and bark. Some Baboons even have cravings for meat. Therefore they can eat birds, rodents, and even younger animals such as sheep. 

Gibbon: Gibbons thrive on fruit trees in the rain forest, and are particularly fond of figs. 

Chimpanzee: Like baboons, chimps also seem to have a diverse diet. On top of eating leaves, fruits and nuts, Chimps also eat several different types of food including ones that are widely known to humans. Because Chimps are often domesticated as well, they are fed human food along with their owners.

C. Adaptation
Lemurs: Lemurs’ dietary habits greatly influence their environment, and vice versa. Because lemurs eat whole fruits, which includes the seeds, then once dispersed, the seeds then turn into plants which ultimately contributes to their habitat. This means that lemurs and other wildlife play a crucial role in rebuilding the many rainforests that are being destroyed.
Spider Monkey: Since spider monkeys live in the rainforest, they eat fruits and nuts, as that is what is most available to them. In addition spider monkeys rely on the rain forests to build their habitats as they mostly live in the upper layers of trees know as canopies. Spider monkeys also utilize the trees as a mode of transportation as they swing across the branches.
Baboon: Baboons are among the more common primates who eat everything ranging from leaves to the meat of small animals. These primates do not have long tails used for gripping trees, but nonetheless they build their habitats in trees and sleep in them.
Gibbon: Gibbons are perhaps the most adapted to their environment out of all the other primates. They only live in the trees and are rarely ever on the ground. Their bodies are essentially constructed for living in trees. They have hooked shaped hands which allow them to grip branches easier and also have extremely long arms in order to move from branch to branch.
Chimpanzee: Chimpanzees are what are known as the closest primates to humans. In fact humans and chimps share more than 98 percent of the same DNA. Their environments greatly vary because a lot of chimps are now being domesticated. This of course is out of nature for these primates, and is very dangerous because they are still wild creatures. If they are not domesticated, chimps live in the rain forest and are very used to their surroundings.

D. Photographs

Lemurs: 

Spider Monkey: 

Baboon: 

Gibbon: 

Chimpanzee: 

Analogy/Homology Blog Post

1.For your homologous traits provide the following information (25 pts):

a.                  Briefly describe the two different species that possess the homologous trait. (5 pts)

Two different species that possess homologous traits are whales and Homo sapiens. Whales are a species that have two fins and a tail, which allows them to live in the ocean. Homo sapiens are a species with two arms and two legs, which allows them to live on land.

b.                  Describe the homologous trait of each species, focusing on the differences in structure and function of the trait. Why do these homologous traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)

A common homologous feature among whales and Homo sapiens is the whale’s fin and a person’s arm. They both possess a skeletal structure that includes an ulna, radius, carpal bones, metacarpal bones, and phalanges. Although the configuration is not quite the same, as a fin is somewhat round shaped and an arm is long with a wrist and five fingers at the end of it.

c.                  Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait? (5 pts)

Whales and Homo sapiens are both classified as mammals, which all possess a similar limb structure. Therefore, this particular trait was inherited form a common ancestor, which most likely differentiated over time as a result of environmental change. It is possible that whales once possessed legs as well, but eventually lost them and gained fins. People still need their legs to survive, which is why we still have them.

d.                  Provide an image of each species in this comparison. (5 pts)

 

2. For your analogous traits provide the following information (25 pts):

a.                  Briefly describe the two different species that possess the analogous trait.  (5 pts)

Two different species that have an analogous trait are turtles and snails. Snails and turtles both have an outer shell which they use as protection from their predators.

b.                  Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait.  Clearly explain why these analogous traits exhibit similarities between the two species.  (10 pts)

Turtles and snails both possess protective shells. Both species are very slow, so they utilize their shells as a type of defense against predators. Typically turtle shells are very durable, as they are made of bone, similar to a vertebra. Meanwhile, snail shells are less durable and act as the species’ only bone in the form of an exoskeleton.  

c.                  All pairs of organisms share some common ancestor if you go back far enough in time.  Did the common ancestor of these two species possess this analogous trait?  Why or whynot?  (5 pts)

Ancestors of neither turtles nor snails had a protective outer shell. Turtles are classified as reptiles and ancestral reptiles did not have shells like this. Snails came from slugs and other species without shells. Therefore, there was no shelled common ancestor that passed this trait onto either organism.

d.                     Provide an image of each species in this comparison.  (5 pts)

Protein Synthesis: DNA Code

Here is my DNA strand. Best of luck on decoding this one! :)

ATTGGCCGATTGTACCAAGTCACATCTAATCAAGTGAGCTGACCATGCATCATTGGCCGATTG

Historical Influences on Darwin

In 1798, Thomas Malthus published “Essay on the Principle of Population”, a piece that would later be highly commended and utilized by Charles Darwin.

• Despite his role as a minster of the Church of England, Malthus suggested numerous theories that strayed from the optimistic social philosophies of his day.
•  Malthus’ most popular theories were those on population, which he wrote about in six editions of “Essay on the Principle of Population”.
•   Malthus suggested that all populations grow at an exponential rate, while food rations grow at an arithmetic rate.
•   Malthus believed that starvation and illnesses were natural consequences of population growth.

Thomas Malthus believed that the human population would inevitably decrease over the years because there are not enough food rations to support the ever-growing population. Malthus suggested this would result to competition and the fittest would get the food, reproduce, and spread their genes. This is the basis of Darwin's theory, natural selection, which suggests that scarcity of resources leads to “survival of the fittest”. Therefore only the survivors will have the ability to reproduce, sending their genes to the next generation, which in turn creates more of the species with the modified genes.

I don’t believe that Darwin would have been able to develop his theory of “natural selection” without Thomas Malthus’ influence and ideals on population. Malthus came very close to discovering “natural selection” on his own. He understood that exponential growth was challenged by limited resources and that there was competition within populations for those limited resources. The only things that he failed to recognize was that his theories could be applied to all species and that variation existed amongst the species.  

For centuries, scientist feared the impending doom that would surround them if they challenged the church on an issue. For much of Darwin’s career, he too was scared to publish his findings. However, Darwin realized that if he waited too long, he may not be recognized for his discoveries. Therefore, Darwin decided to rise above the churches’ influence and publish his first book, On the Origin of Species.

External Sources: http://www.allaboutscience.org/malthus-faq.htm